Chst10 antibody thermo
WebRabbit polyclonal antibody raised against synthetic peptide of CHST10.IgGy Antibody Selector – Quickly search hundreds of thousands of antibodies available for … WebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% …
Chst10 antibody thermo
Did you know?
WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; WebAntibodies that detect CD16/CD32 can be used in several scientific applications, including Flow Cytometry, ELISA, Functional assay, Immunohistochemistry and Immunoprecipitation. These antibodies target CD16/CD32 in Mouse and Rhesus Monkey samples. Our CD16/CD32 monoclonal, polyclonal and recombinant monoclonal antibodies are …
WebATP7B Antibodies. Antibodies that detect ATP7B can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, Immunoprecipitation and ELISA. These antibodies target ATP7B in Human, Rat and Mouse samples. Our ATP7B polyclonal and monoclonal antibodies are developed in Rabbit … WebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 …
WebBest Art Classes in Fawn Creek Township, KS - Elaine Wilson Art, Tallgrass Art Gallery, Bevs Ceramic Shed, MillieArt WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity …
WebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map.
WebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution; Synonyms: Anti-Carbohydrate sulfotransferase 10,Anti-HNK-1 sulfotransferase,Anti-HNK-1ST,Anti-HNK1ST,Anti-huHNK-1ST; find Sigma-Aldrich-HPA012884 MSDS, related peer … read my reviewshow to stop static cling in clothesWebBuy rabbit polyclonal antibody to CHST10 (A37117). Validated Applications: WB and IHC. Tested Reactivity: Human. ️ Low Prices ️ 100% Guarantee read my routerWebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … read my screen appWebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 … read my scheming princeWebWe offer a wide range of validated CHST10 antibodies. Order online or by email, fax, or phone. ️ Low Prices ️ 100% Guarantee ️ FREE Shipping read my roomWebCarbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR): Novus Biologicals View Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR). Validated Applications: IHC, IHC-P. Validated Species: Human. Skip to main content Support: 1-888-506-6887 Items in Cart (0) [X] … read my runes